Prev. | 

RIKEN DNA Bank Human Resource - KIAA1191

Gene ID NCBI Gene 57179 |  KEGG hsa:57179
Gene Symbol KIAA1191
Protein Name KIAA1191
Synonyms p33MONOX|p60MONOX
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004862 IRAK012C14 pCMV-SPORT6 BC010448 NM_020444 Full
HGY089364 IRAL023G20 pOTB7 BC017097 NM_020444 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071652 ARe79C04 pKA1U5 NM_020444.3  
GGGTACTGCTACCTAGNTGGGTCTTGGGGACCTTCGAAATCGCCGCCGCTCTCACAATGG
HKR181284 ARi53D12 pGCAP10 NM_020444.3  
GGTACTGCTACCTAGTGGGTCTTGGGGACCTTCGAAATCGCCGCCGCTCTCACAATGGCT
HKR181332 ARi53F12 pGCAP10 NM_020444.3  
GGACCCGCCTGCGGGCGGCTGGCGGCGCCCACACTGCTCGCTGGGCCTCGGCTCCNGGNT
HKR345353 RBb63G09 pGCAP1 NM_020444.3  
GGGTCTCCGGAGGCTTTATCTGCAGTGCTGCCTGCCCGCTGGGTGGTACTGCTACCTAGT
HKR386051 RBd65C03 pGCAP10 NM_020444.3  
GCTGCCCGCTGGGTGGTACTGCTACCTAGTGGGTCTTGGGGACCTTCGAAATCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl