Prev. |  KEGG KO K13886 > 

RIKEN DNA Bank Human Resource - CORO1B

Gene ID NCBI Gene 57175 |  KEGG hsa:57175
Gene Symbol CORO1B
Protein Name coronin 1B
Synonyms CORONIN-2
Ortholog resources KEGG ortholog (KEGG orthology K13886) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087508 IRAL018M20 pOTB7 BC006449 NM_020441 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076836 ARe92B12 pKA1U5 NM_001018070.1  
GACTTCCTGAATCCTGCTTCCTGCTTCCCAGAGGCCGGGATCCGGAGCCGCCCGAAGCCG
HKR260309 ARiS150M21 pGCAP10 NM_001018070.1  
GNCNNCCTNAATCCTGCTTCCTGCTTCCNANAGGCCGGGATCCGGAGCCGCCCGAAGCCG
HKR398807 RBd97A07 pGCAP10 NM_001018070.1  
GCTGCTTCCCAGAGGCCGGGATCCGGAGCCGCCCGAAGCCGGTGCCGCAGCCCCCTGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl