RIKEN DNA Bank Human Resource - SLC44A2
|
Ortholog resource in our bank SLC44A2 External database KEGG gene KEGG Ortholog NCBI Gene |
Genome Network Project (GNP) Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | Sequence | CDS status(2) | |
|---|---|---|---|---|---|
| Submitted (DDBJ)(1) | Refered (NCBI mRNA) | ||||
| HGX005345 | IRAK013G01 | pCMV-SPORT6 | BC010617 | NM_020428 | Partial/var |
(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.
GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv
NRCD Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | mRNA RefSeqs/DDBJ accession(1) | Status |
|---|---|---|---|---|
| 5'-terminal sequence(2) | ||||
| HKR174147 | ARi35G03 | pGCAP10 | NM_001145056.1 |  |
| GGGAGCCTCCCGCCCGCCCGGGCTGGGGTCGCGCTGGCTCGGACTCCGCTCCCCGCCCCG | ||||
♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.
NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv
2022.09.29
Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl