Prev. |  KEGG KO K12197 > 

RIKEN DNA Bank Human Resource - CHMP1B

Gene ID NCBI Gene 57132 |  KEGG hsa:57132
Gene Symbol CHMP1B
Protein Name charged multivesicular body protein 1B
Synonyms C10orf2|C18-ORF2|C18orf2|CHMP1.5|Vps46-2|Vps46B|hVps46-2
Ortholog resources KEGG ortholog (KEGG orthology K12197) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056318 IRAK140N06 pCMV-SPORT6 BC065933 NM_020412
HGY090056 IRAL025C08 pOTB7 BC012733 NM_020412 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049228 ARe23B04 pKA1U5 NM_020412.3  
ACTTACCTTACCTTCTCTGCCTTCGGCGCGCTTCTCAGCAGGGCCGCCGACCCAAAGGAG
HKR069775 ARe74H07 pKA1U5 NM_020412.3  
AAAAACAAAGGAGCGGCGGCCGGGAGCGGACTTACCTTACCTTCTCTGCCTTCGGCGCGC
HKR072858 ARe82C10 pKA1U5 NM_020412.3  
ATCCTGACCTTACCTTCTCTGCCTTCGGCGCGCTTCTCAGCCGGGCCGCCGACCCAAAGG
HKR181778 ARi54H10 pGCAP10 NM_020412.3  
GAGTAGAAACAGGAAGTGGGACCAAAACAAAGGAGCGGCGGCCGGGAGCGGACTTACCTT
HKR209462 ARiS023K22 pGCAP10 NM_020412.3  
GAGTAGAAACAGGAAGTGGGACCAAAACAAAGGAGCGGCGGCCGGGAGCGGACTTACCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl