Prev. |  KEGG KO K17428 > 

RIKEN DNA Bank Human Resource - MRPL47

Gene ID NCBI Gene 57129 |  KEGG hsa:57129
Gene Symbol MRPL47
Protein Name mitochondrial ribosomal protein L47
Synonyms CGI-204|L47mt|MRP-L47|NCM1
Ortholog resource in our bank

  MRPL47

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027749 IRAK069G05 pCMV-SPORT6 BC032522 NM_177988 Full
HGY096008 IRAL040A08 pOTB7 BC021575 NM_177988 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094004 M01C035A04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094052 M01C035C04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094100 M01C035E04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094148 M01C035G04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094196 M01C035I04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094244 M01C035K04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094292 M01C035M04 pDONR221 MGC07-B02 BC032522 NM_177988  
HGE094340 M01C035O04 pDONR221 MGC07-B02 BC032522 NM_177988  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR396883 RBd92D11 pGCAP10 NM_020409.2  
GGTTTTGCCAGTTATGCGAAAACATGGCTGCGGCCGGTTTGGCCCTTCTTTGTAGGAGAG
HKR462629 RBdS156J13 pGCAP10 NM_020409.2  
GGGAAACGCGTTTTGCCAGTTATGCGAAAACATGGCTGCGGCCGGTTTGGCCCTTCTTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl