Prev. | 

RIKEN DNA Bank Human Resource - NAT14

Gene ID NCBI Gene 57106 |  KEGG hsa:57106
Gene Symbol NAT14
Protein Name N-acetyltransferase 14 (putative)
Synonyms KLP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095678 IRAL039D06 pOTB7 BC019079 NM_020378

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000721 W01A001N09 pENTR-TOPO IRAL039D06 BC019079 NM_020378  
HGE000723 W01A001N11 pENTR-TOPO IRAL039D06 BC019079 NM_020378  
HGE000727 W01A001N15 pENTR-TOPO IRAL039D06 BC019079 NM_020378  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049675 ARe24D03 pKA1U5 NM_020378.2  
ACTTCCGCCCGCGACCCCCTTCCAGACCCGCTCCCGAAACCTTGTCGAAGGACCAAAGGC
HKR175654 ARi39C06 pGCAP10 NM_020378.2  
GAGACCCGCTCCCGAAACCTTGTCGAAGGACCAAAGGCGACCGGTGCAGGTGCACGACGC
HKR398175 RBd95H07 pGCAP10 NM_020378.2  
GAGACCCGCTCCCGAAACCTTGTCGAAGGACCAAAGGCGACCGGTGCAGGTGCACGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl