Prev. |  KEGG KO K19497 > 

RIKEN DNA Bank Human Resource - ANO2

Gene ID NCBI Gene 57101 |  KEGG hsa:57101
Gene Symbol ANO2
Protein Name anoctamin 2
Synonyms C12orf3|TMEM16B
Ortholog resources KEGG ortholog (KEGG orthology K19497) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR461701 RBdS154E05 pGCAP10 NM_020373.2  
GAGAAGCGCGCGGCCGCGGGCCGGCGGGGTCCGCGTCCACATCATGGCGACTCCCGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl