Prev. | 

RIKEN DNA Bank Human Resource - PCNP

Gene ID NCBI Gene 57092 |  KEGG hsa:57092
Gene Symbol PCNP
Protein Name PEST proteolytic signal containing nuclear protein
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013389 IRAK033H21 pBluescriptR BC022001 NM_020357 Full/var
HGY092502 IRAL031E06 pDNR-LIB BC013916 NM_020357 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004234 W01A010J18 pENTR-TOPO IRAK033H21 BC022001 NM_020357  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178002 ARi45A02 pGCAP10 NM_020357.1  
GGGAAAATGGCGGACGGGAAGGCGGGAGACGAGAAGCCTGAAAAGTCGCAGCGAGCTGGA
HKR208242 ARiS020K02 pGCAP10 NM_020357.1  
GGCGGCGGGGAAAATGGCGGACGGGAAGGCGGGAGACGAGAAGCCTGAAAAGTCGCAGCG
HKR243815 ARiS109I23 pGCAP10 NM_020357.1  
GGGCGGGGAAAATGGCGGACGGGAAGGCGGGAGACGAGAAGCCTGAAAAGTCGCAGCGAG
HKR372524 RBd31F04 pGCAP10 NM_020357.1  
GGAAAAATGGCGGACGGGAAGGCGGGAGACGAGAAGCCTGAAAAGTCGCAGCGAGCTGGA
HKR390074 RBd75D02 pGCAP10 NM_020357.1  
GCTTGGCGTGGCTGCAGGGGAGGCCGCGGCGGGGAAAATGGCGGACGGGAAGGCGGGAGA
HKR433292 RBdS083D20 pGCAP10 NM_020357.1  
TAAAAATGGCGGACGGGAAGGCGGGAGACGAGAAGCCTGAAAAGTCGCAGCGAGCTGGAG
HKR462679 RBdS156L15 pGCAP10 NM_020357.1  
GGCGGCGGGGAAAATGGCGGACGGGAAGGCGGGAGACGAGAAGCCTGAAAAGTCGCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl