Prev. |  KEGG KO K21444 > 

RIKEN DNA Bank Human Resource - PCBP4

Gene ID NCBI Gene 57060 |  KEGG hsa:57060
Gene Symbol PCBP4
Protein Name poly(rC) binding protein 4
Synonyms CBP|LIP4|MCG10
Ortholog resources KEGG ortholog (KEGG orthology K21444) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081121 IRAL002N09 pOTB7 BC004153 NM_033010 Full
HGY083887 IRAL009L23 pOTB7 BC003008 NM_033010 Full
HGY089318 IRAL023E22 pOTB7 BC017098 NM_033010 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324832 RBb12B08 pKA1U5 NM_020418.2  
GGTCAAACCCCTCATTGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCC
HKR326884 RBb17D12 pKA1U5 NM_020418.2  
GAAACCCCTCATTGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCGG
HKR328129 RBb20F09 pKA1U5 NM_020418.2  
GGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCGGGGACAATGTGGG
HKR376082 RBd40D10 pGCAP10 NM_020418.2  
AAAAACCCCTCATTGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCG
HKR386802 RBd67A02 pGCAP10 NM_020418.2  
GAGATNTGANCNGNCGNCTCTCCCGNGNACAANGNGGGANNGAGNGGGCCNNCCGCCNGG
HKR406382 RBdS015P22 pGCAP10 NM_020418.2  
CGGCCGGCCGATGAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCGGGGACAA
HKR409110 RBdS022M22 pGCAP10 NM_020418.2  
GGCAGTTGTGAGCGGCCGCCTCTCCCGGGGACAATGTGGGACTGAGCGGCCCAGCCGCCG
HKR416085 RBdS040D13 pGCAP10 NM_020418.2  
TTGGCGAGTTGTGAGCGGCCGCCTCTCCCGGGGACAATGTGGGACTGAGCGGCCCAGCCG
HKR416089 RBdS040D17 pGCAP10 NM_020418.2  
GGTTGTGAGCGGCCGCCTCTCCCGGGGACAATGTGGGACTGAGCGGCCCAGCCGCCGTGC
HKR428289 RBdS070M01 pGCAP10 NM_020418.2  
GAAACCCCTCATTGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCGG
HKR430265 RBdS075L01 pGCAP10 NM_020418.2  
TTGGGAGCCGGGCTCCGGGCCGGCCGGGCTCCGCGCCTGTCAAACCCCTCATTGTTCGCA
HKR444260 RBdS110K20 pGCAP10 NM_020418.2  
GAAACCCCTCATTGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCGG
HKR471123 RBdS177N11 pGCAP10 NM_020418.2  
TTTGTTCGCAGCTGATGTCACTCGCAGTTGTGAGCGGCCGCCTCTCCCGGGGACAATGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl