Prev. | 

RIKEN DNA Bank Human Resource - PLSCR3

Gene ID NCBI Gene 57048 |  KEGG hsa:57048
Gene Symbol PLSCR3
Protein Name phospholipid scramblase 3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091175 IRAL027P15 pOTB7 BC011735 NM_020360 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018599 W01A046I07 pENTR-TOPO IRAL027P15 BC011735 NM_020360  
HGE018605 W01A046I13 pENTR-TOPO IRAL027P15 BC011735 NM_020360  
HGE018607 W01A046I15 pENTR-TOPO IRAL027P15 BC011735 NM_020360  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061325 ARe53F05 pKA1U5 NM_020360.2  
GGTGAGCTGCCGAGNTGCTAGGCACCCGGGCTCTTCTGGGGGCTCCAGTCAGAGGCGCCG
HKR170521 ARi26F01 pGCAP10 NM_020360.2  
GACCGTTTGGCGGCCTGTCACCCGCGTGGCTGGGGCACCTGCAGAAACTGCTGTCGCTGC
HKR218280 ARiS045L16 pGCAP10 NM_020360.2  
GCTTCTGGGGGCTCCAGAGGCGCCGCCCAAGAGACCCTGGGCCGGCGCCGGGCGCAGCTG
HKR277977 ARiS194P17 pGCAP10 NM_020360.2  
GACCCGGGNTCTTCTGGGGGCTCCNNAGGCGCCNCCCAAGAGACCCTGGGCCGGCGCCGG
HKR333675 RBb34D03 pGCAP1 NM_020360.2  
GGACCCTGGGCCGGCGCCGGGCGCAGCTGCCTCTCCGTCTTTGTGTCTGTCTCTGTGTCT
HKR369723 RBd24F03 pGCAP10 NM_020360.2  
GGGCCCACAGCCTCCTCCGCAGGATGGGAGAACAAAGGGAGGGGGCGGTTCTGGGGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl