Prev. |  KEGG KO K01887 > 

RIKEN DNA Bank Human Resource - RARS2

Gene ID NCBI Gene 57038 |  KEGG hsa:57038
Gene Symbol RARS2
Protein Name arginyl-tRNA synthetase 2, mitochondrial
Synonyms ArgRS|DALRD2|PCH6|PRO1992|RARSL
Ortholog resources KEGG ortholog (KEGG orthology K01887) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089567 IRAL023P07 pOTB7 BC010420 NM_020320
HGY094009 IRAL035A09 pDNR-LIB BC022341 NM_020320 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375348 RBd38G04 pGCAP10 NM_020320.3  
GACTTCCGTAGAGGTGGACATGGCGTGCGGCTTTCGCCGCGCTATTGCTTGCCAGAGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl