Prev. |  KEGG KO K07758 > 

RIKEN DNA Bank Human Resource - PDXP

Gene ID NCBI Gene 57026 |  KEGG hsa:57026
Gene Symbol PDXP
Protein Name pyridoxal phosphatase
Synonyms CIN|PLP|dJ37E16.5
Ortholog resources KEGG ortholog (KEGG orthology K07758) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056195 IRAK140I03 pCMV-SPORT6 BC064922 NM_020315
HGY080551 IRAL001G07 pOTB7 BC000320 NM_020315 Full
HGY085894 IRAL014M06 pOTB7 BC009756 NM_020315 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081230 M01C003B06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081278 M01C003D06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081326 M01C003F06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081374 M01C003H06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081422 M01C003J06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081470 M01C003L06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081518 M01C003N06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE081566 M01C003P06 pDONR221 04-134-2_2-D03 BC000320 NM_020315  
HGE099611 M01C049A11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099659 M01C049C11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099707 M01C049E11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099755 M01C049G11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099803 M01C049I11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099851 M01C049K11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099899 M01C049M11 pDONR221 MGC14-A06 BC000320 NM_020315  
HGE099947 M01C049O11 pDONR221 MGC14-A06 BC000320 NM_020315  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048850 ARe22C02 pKA1U5 NM_020315.4  
GGAGAGCGCGGCGCGGGAGGCCGGCGGCCGGCCGGCTGCATGGCGCGCTGCGAGAGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl