Prev. |  KEGG KO K22746 > 

RIKEN DNA Bank Human Resource - CIAPIN1

Gene ID NCBI Gene 57019 |  KEGG hsa:57019
Gene Symbol CIAPIN1
Protein Name cytokine induced apoptosis inhibitor 1
Synonyms Anamorsin|CIAE2|DRE2|PRO0915
Ortholog resources KEGG ortholog (KEGG orthology K22746) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018534 IRAK046F14 pBluescriptR BC024196 NM_020313 Full
HGX056741 IRAK141O05 pCMV-SPORT6.1 BC067303 NM_020313 Full
HGX066773 IRAK166P13 pCMV-SPORT6 BC071740 NM_020313 Full
HGY081981 IRAL004P21 pOTB7 BC002568 NM_020313 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR334828 RBb37B04 pGCAP1 NM_020313.1  
GGAGTCGACGGCTGGAGAGAAGCCGGGAAGCGAGCCCAGGCGGCAGTCTTGATTCCCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl