Prev. |  KEGG KO K04304 > 

RIKEN DNA Bank Human Resource - ACKR3

Gene ID NCBI Gene 57007 |  KEGG hsa:57007
Gene Symbol ACKR3
Protein Name atypical chemokine receptor 3
Synonyms CMKOR1|CXC-R7|CXCR-7|CXCR7|GPR159|RDC-1|RDC1
Ortholog resource in our bank

  ACKR3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019068 IRAK047L04 pBluescriptR BC036661 NM_020311 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006037 W01A015B13 pENTR-TOPO IRAK047L04 BC036661 NM_020311  
HGE006039 W01A015B15 pENTR-TOPO IRAK047L04 BC036661 NM_020311  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045231 ARe13B07 pKA1U5 NM_020311.2  
TGACAGTTGTTGCAAAGTGCTCAGCACTAAGGGAGCCAGCGCACAGCACAGCCAGGAAGG
HKR052878 ARe32D06 pKA1U5 NM_020311.2  
GTGACAGTTGTTTGCAAAGTGCTCAGCACTAAGGGAGCCAGCGCACAGCACAGCCAGGAA
HKR160502 ARi01E06 pGCAP10 NM_020311.2  
GACAGTTGTTGCAAAGTGCTCAGCACTAAGGGAGCCAGCGCACAGCACAGCCAGGAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl