Prev. |  KEGG KO K00994 > 

RIKEN DNA Bank Human Resource - CHPT1

Gene ID NCBI Gene 56994 |  KEGG hsa:56994
Gene Symbol CHPT1
Protein Name choline phosphotransferase 1
Synonyms CPT|CPT1
Ortholog resources KEGG ortholog (KEGG orthology K00994) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039572 IRAK098P12 pCMV-SPORT6 BC050429 NM_020244 Full
HGY094742 IRAL036O06 pDNR-LIB BC020819 NM_020244 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE085229 M01C013B05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085277 M01C013D05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085325 M01C013F05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085373 M01C013H05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085421 M01C013J05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085469 M01C013L05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085517 M01C013N05 pDONR221 FLJ04-C03 AK075211 NM_020244  
HGE085565 M01C013P05 pDONR221 FLJ04-C03 AK075211 NM_020244  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186028 ARi65B04 pGCAP10 NM_020244.2  
GCCCGAGGCCCCGCCCCACCCGCGAGCCGCAGCCGCGGCCCCACAGCTTCTGGGGCTGGG
HKR331629 RBb29B05 pGCAP1 NM_020244.2  
GGCCCCACCCGCGAGCCGCANCCGCGGCCCCACAGCATTCTGGGGCTGGGGCCCCGGCAG
HKR444189 RBdS110H21 pGCAP10 NM_020244.2  
GGCCCCACCCGCGAGCCGCAGCCGCGGCCCCACAGCTTCTGGGGCTGGGGCCCCGGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl