Prev. |  KEGG KO K17769 > 

RIKEN DNA Bank Human Resource - TOMM22

Gene ID NCBI Gene 56993 |  KEGG hsa:56993
Gene Symbol TOMM22
Protein Name translocase of outer mitochondrial membrane 22
Synonyms 1C9-2|MST065|MSTP065|TOM22
Ortholog resource in our bank

  TOMM22

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090756 IRAL026O20 pOTB7 BC009363 NM_020243 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004066 W01A010C18 pENTR-TOPO IRAL026O20 BC009363 NM_020243  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170810 ARi27A10 pGCAP10 NM_020243.4  
GTCCTTTCCGCTTCCGGTGTCCCCTACAGTCATGGCTGCCGCCGTCGCTGCTGCCGGTGC
HKR178412 ARi46A12 pGCAP10 NM_020243.4  
GGGTGCAGGGGAACCCCAGTCCCCGGACGAATTGCTCCCGAAAGGCGACGCGGAGAAGCC
HKR320528 RBb01F08 pKA1U5 NM_020243.4  
GAGTCATGGCTGCCGCCGTCGCTGCTGCCGGNCCNTGGGAACCCCAGTCCCCGGACGAAT
HKR338505 RBb46E09 pGCAP1 NM_020243.4  
HKR347372 RBb68H04 pGCAP1 NM_020243.4  
GGCCCTAGCTCCAGTGGGGCTCGGCGGCTCCCAGTGCCGCAGCGGGGCCAGGAATGGATG
HKR361682 RBd04D10 pGCAP10 NM_020243.4  
GACAGTCATGGCTGCCGCCGTCGCTGCTGCCGGTGCAGGGGAACCCCAGTCCCCGGACGA
HKR382524 RBd56F04 pGCAP10 NM_020243.4  
GCTCCTTTCCGCTTCCGGTGTCCCCTACAGTCATGGCTGCCNCNNNNNNTGCTGCCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl