Prev. |  KEGG KO K13566 > 

RIKEN DNA Bank Human Resource - NIT2

Gene ID NCBI Gene 56954 |  KEGG hsa:56954
Gene Symbol NIT2
Protein Name nitrilase family member 2
Synonyms HEL-S-8a
Ortholog resource in our bank

  NIT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095114 IRAL037N02 pDNR-LIB BC020620 NM_020202 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048880 ARe22D08 pKA1U5 NM_020202.3  
GCCCGCCGGATCTCCAGCGCTCAGTCCGCGCCGCAGGTGGTGCTTGTCTGCAGAGTCATG
HKR321727 RBb04F07 pKA1U5 NM_020202.3  
GGTCTGCAGAGTCATGACCTCTTTCCGCTTGGCCCTCATCCAGCTTCAGATTTCTTCCAT
HKR365380 RBd13H12 pGCAP10 NM_020202.3  
GGTCCGCGCCGCAGGTGGTGCTTGTCTGCAGAGTCATGACCTCTTTCCGCTTGGCCCTCA
HKR405739 RBdS014F19 pGCAP10 NM_020202.3  
CAGTCCGCGCCGCAGGTGGTGCTTGTCTGCAGAGTCATGACCTCTTTCCGCTTGGCCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl