Prev. | 

RIKEN DNA Bank Human Resource - PRTFDC1

Gene ID NCBI Gene 56952 |  KEGG hsa:56952
Gene Symbol PRTFDC1
Protein Name phosphoribosyl transferase domain containing 1
Synonyms HHGP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005460 IRAK013K20 pCMV-SPORT6 BC008662 NM_020200 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063234 ARe58B10 pKA1U5 NM_020200.5  
GGTCTTCCCTTCCCGCGGTTCCCCGGGAGAAACATGGCCGGGAGCAGCGAGGAGGCGCCA
HKR166433 ARi16B09 pGCAP10 NM_020200.5  
GGAACATGGCCGGGAGCAGCGAGGAGGCGCCAGACTACGGGCGAGGCGTCGTGATTATGG
HKR336521 RBb41F01 pGCAP1 NM_020200.5  
GGTCTTCCCTTCCCGCGTTCCCCGGGAGAAACATGGCCGGGAGCAGCGAGGAGGCGCCAG
HKR452883 RBdS132D11 pGCAP10 NM_020200.5  
GTTCCCTTCCCGCGTTCCCCGGGAGAAACATGGCCGGGAGCAGCGAGGAGGCGCCAGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl