Prev. | 

RIKEN DNA Bank Human Resource - C5orf15

Gene ID NCBI Gene 56951 |  KEGG hsa:56951
Gene Symbol C5orf15
Protein Name chromosome 5 open reading frame 15
Synonyms HTGN29|KCT2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094545 IRAL036G01 pDNR-LIB BC020875 NM_020199 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE106832 M01C067B08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE106880 M01C067D08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE106928 M01C067F08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE106976 M01C067H08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE107024 M01C067J08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE107072 M01C067L08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE107120 M01C067N08 pDONR221 06_08-D04 AK074963 NM_020199  
HGE107168 M01C067P08 pDONR221 06_08-D04 AK074963 NM_020199  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005363 W01A013G19 pENTR-TOPO IRAL036G01 BC020875 NM_020199  
HGE005365 W01A013G21 pENTR-TOPO IRAL036G01 BC020875 NM_020199  
HGE005367 W01A013G23 pENTR-TOPO IRAL036G01 BC020875 NM_020199  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057604 ARe44A04 pKA1U5 NM_020199.2  
GAGCCGAGTCCGTTATGGCCGCTGCCGTCCCGAAGAGGATGAGGGGGCCAGCACAAGCGA
HKR081328 ARf03F08 pKA1U5 NM_020199.2  
GGCAGGCTCCCAGCCGAGTCCGTTATGGCCGCTGCCGTCCCGAAGAGGATGAGGGGGCCA
HKR082033 ARf05B09 pKA1U5 NM_020199.2  
GAGGCTCCCAGCCGAGTCCGTTATGGCCGCTGCCGTCCCGAAGAGGATGAGGGGGCCAGC
HKR338946 RBb47G02 pGCAP1 NM_020199.2  
GGCTCCCAGCCGAGTCCGTTATGGCCGCTGCCGTCCCGAAGAGGATGAGGGGGCCAGCAC
HKR462721 RBdS156N09 pGCAP10 NM_020199.2  
GAACNNCGCAGGCTCCCAGCCGAGTCCGTTATGGCCGCTGCCGTCCCGAAGAGGATGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl