RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SMYD2

Gene ID	NCBI Gene 56950 \| KEGG hsa:56950
Gene Symbol	SMYD2
Protein Name	SET and MYND domain containing 2
Synonyms	HSKM-B\|KMT3C\|ZMYND14

Ortholog resource in our bank

  SMYD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX008227	IRAK020J11	pCMV-SPORT6	BC017080	NM_020197	Partial
HGX032899	IRAK082E03	pCMV-SPORT6	BC039890	NM_020197	Partial/var
HGY042503	IRAK106E07	pBluescript	BC049367	NM_020197	Partial/var
HGY067471	IRAK168L07	pBluescriptR	BC068511	NM_020197	Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR276626	ARiS191J10	pGCAP10	NM_020197.2
HKR276626	GGCCCTCCCTTCCGGGGAGCGGGAAGCCGCCGCCGCGTCCGCCGGGCGGCTCCCNCCCCG
HKR323273	RBb08D01	pKA1U5	NM_020197.2
HKR323273	GGGAGCGCGCGCGGGGCGGCCGCCGAGGGTCGCGNNGCTAGGCGGGGCCGCCGGGCCCGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl