Prev. |  KEGG KO K11368 > 

RIKEN DNA Bank Human Resource - ENY2

Gene ID NCBI Gene 56943 |  KEGG hsa:56943
Gene Symbol ENY2
Protein Name ENY2 transcription and export complex 2 subunit
Synonyms DC6|Sus1|e(y)2
Ortholog resource in our bank

  ENY2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088348 IRAL020O12 pOTB7 BC007870 NM_020189

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180100 ARi50E04 pGCAP10 NM_020189.4  
GGTTCTAGCTTTCTGTGTGCTTAGGTGCCCGAGCTACTGAGGGTCTAAGTCCGGGCAGCC
HKR320906 RBb02E10 pKA1U5 NM_020189.4  
GACTGAGGGTCTAAGTCCGGGCAGCCGAAGAGTGTGGTAGGTAACGGTCCTCAGCGCAAG
HKR347259 RBb68C11 pGCAP1 NM_020189.4  
GGAGTGTGGTAGGTAACGGTCCTCAGCGCAAGGGTCATTTCGTCGCTGGGAAGGGACGGC
HKR382155 RBd55G11 pGCAP10 NM_020189.4  
GACTGAGGGTCTAAGTCCGGGCAGCCGAAGAGTGTGGTAGGTAACGGTCCTCAGCGCAAG
HKR383654 RBd59C06 pGCAP10 NM_020189.4  
GGGAAATGCGTGTTCTAGCTTTCTGTGTGCTTAGGTGCCCGAGCTACTGAGGGTCTAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl