Prev. |  KEGG KO K14165 > 

RIKEN DNA Bank Human Resource - DUSP22

Gene ID NCBI Gene 56940 |  KEGG hsa:56940
Gene Symbol DUSP22
Protein Name dual specificity phosphatase 22
Synonyms JKAP|JSP-1|JSP1|LMW-DSP2|LMWDSP2|MKP-x|MKPX|VHX
Ortholog resource in our bank

  DUSP22

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090127 IRAL025F07 pOTB7 BC022847 NM_020185

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004513 W01A011E17 pENTR-TOPO IRAL025F07 BC022847 NM_020185  
HGE004515 W01A011E19 pENTR-TOPO IRAL025F07 BC022847 NM_020185  
HGE004519 W01A011E23 pENTR-TOPO IRAL025F07 BC022847 NM_020185  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247506 ARiS118M18 pGCAP10 NM_020185.3  
GACGCGCTCTGGCCTCCGGGGCCGGCCGCCTGGGAGCCCGAGCCTAGTGCCTCCCACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl