RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DUS3L

Gene ID	NCBI Gene 56931 \| KEGG hsa:56931
Gene Symbol	DUS3L
Protein Name	dihydrouridine synthase 3 like
Synonyms	DUS3

Ortholog resource in our bank

  DUS3L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY086314	IRAL015N02	pOTB7	BC004549	NM_020175	Partial/var
HGY089573	IRAL023P13	pOTB7	BC008362	NM_020175	Partial/var
HGY090779	IRAL026P19	pOTB7	BC009973	NM_020175

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR045653	ARe14C05	pKA1U5	NM_020175.1
HKR045653	GCTTCCCGCCACACTCCAGAGCGGATGTGAGGGGCGCCGATGGCGGAGGGAACGGCGGAG
HKR049351	ARe23G07	pKA1U5	NM_020175.1
HKR049351	GCTTCCCGCCACACTCCAGAGCGGATGTGAGGGGCGCCGATGGCGGAGGGAACGGCGGAG
HKR336100	RBb40E04	pGCAP1	NM_020175.1
HKR336100	TGGCCACACTCCAGAGCGGATGTGAGGGGCGCCGATGGCGGAGGGAACGGCGGAGGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl