RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SPPL2B

Gene ID	NCBI Gene 56928 \| KEGG hsa:56928
Gene Symbol	SPPL2B
Protein Name	signal peptide peptidase like 2B
Synonyms	IMP-4\|IMP4\|PSH4\|PSL1

Ortholog resource in our bank

  SPPL2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY018627	IRAK046J11	pBluescriptR	BC028391	NM_152988	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR078128	ARe95F08	pKA1U5	NM_152988.2
HKR078128	TGGGGCACCGGCCGACATGGCGGCAGCGGTGGCGGCTGCGCTGGCGCGGCTTTTGGCGGC
HKR345673	RBb64D01	pGCAP1	NM_152988.2
HKR345673	GGCCGTTGGTTGCGGCGGGCACCGGCCGACATGGCGGCAGCGGTGGCGGCTGCGCTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl