Prev. | 

RIKEN DNA Bank Human Resource - NCLN

Gene ID NCBI Gene 56926 |  KEGG hsa:56926
Gene Symbol NCLN
Protein Name nicalin
Synonyms NET59
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089012 IRAL022I20 pOTB7 BC007275 NM_020170 Partial
HGY089345 IRAL023G01 pOTB7 BC025926 NM_020170 Full/var
HGY089779 IRAL024H11 pOTB7 BC008920 NM_020170 Partial
HGY090265 IRAL025L01 pOTB7 BC013283 NM_020170 Full
HGY091089 IRAL027M01 pOTB7 BC010064 NM_020170 Full
HGY095830 IRAL039J14 pOTB7 BC019091 NM_020170 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR403141 RBdS007O05 pGCAP10 NM_020170.3  
GGGGGCGGTTCGCCGCGGTGCCCACAGGACCTCAGGGCGAGTGCGGGCTGCCCCGCGCGG
HKR433339 RBdS083F19 pGCAP10 NM_020170.3  
GGTCCGCGGGAGCCGCCGCCGCCGCCGTCCCGTCCCAGCTGCCGCCCCGCGCGGCCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl