Prev. |  KEGG KO K12590 > 

RIKEN DNA Bank Human Resource - EXOSC5

Gene ID NCBI Gene 56915 |  KEGG hsa:56915
Gene Symbol EXOSC5
Protein Name exosome component 5
Synonyms RRP41B|RRP46|Rrp46p|hRrp46p|p12B
Ortholog resource in our bank

  EXOSC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087171 IRAL017P11 pOTB7 BC007742 NM_020158 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040550 W01A101G06 pENTR-TOPO IRAL017P11 BC007742 NM_020158  
HGE040554 W01A101G10 pENTR-TOPO IRAL017P11 BC007742 NM_020158  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR375728 RBd39F08 pGCAP10 NM_020158.3  
GAGGCGGAAGTGACAACTGCAGCCGCACGTGGGCTCGGCGCGATGGAGGAGGAGATGCAT
HKR379323 RBd48F03 pGCAP10 NM_020158.3  
GAGCCGCACGTGGGCTCGGCGCGATGGAGGAGGAGATGCATACTGACGCCAAAATCCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl