Prev. |  KEGG KO K02098 > 

RIKEN DNA Bank Human Resource - SPIRE1

Gene ID NCBI Gene 56907 |  KEGG hsa:56907
Gene Symbol SPIRE1
Protein Name spire type actin nucleation factor 1
Synonyms Spir-1
Ortholog resource in our bank

  SPIRE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092871 IRAL032C23 pDNR-LIB BC016825 NM_020148 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168956 ARi22G12 pGCAP10 NM_020148.2  
GGGCGGCGGTTCCGGGGATGGTGAGGCGGCGGCGCGCGACGANGNTGCTCCGGAGCTGAG
HKR346411 RBb66A11 pGCAP1 NM_020148.2  
AAAGGCCGGACGCCATCGCGTCGCTACCGGCCGGCGGCTGTCTGACCGGGACTGCAGCCG
HKR376498 RBd41E02 pGCAP10 NM_020148.2  
TGGGCGTTGGGCGGCGGCGGTTCCGGGGATGGTGAGGCGGCGGCGCGCGACGACGATGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl