Prev. |  KEGG KO K21269 > 

RIKEN DNA Bank Human Resource - SH3GLB2

Gene ID NCBI Gene 56904 |  KEGG hsa:56904
Gene Symbol SH3GLB2
Protein Name SH3 domain containing GRB2 like, endophilin B2
Synonyms PP6569|PP9455|RRIG1
Ortholog resources KEGG ortholog (KEGG orthology K21269) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080821 IRAL002A21 pOTB7 BC005843 NM_020145 Partial/var
HGY085584 IRAL013P24 pOTB7 BC014635 NM_020145
HGY089550 IRAL023O14 pOTB7 BC008029 NM_020145 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043631 ARe09B07 pKA1U5 NM_020145.2  
GGGCTGCGGCGGGCGGGCAGGCGGGCAGGCCGCCCATNNNGGTGCGCGGAGGGCTGGTGC
HKR066903 ARe67E07 pKA1U5 NM_020145.2  
GGGGCAGGCCGGCAGGCGGGTGCGCGGAGGGCTGTTGCCCCGCAGCAGGTGGGCGGGGTG
HKR082903 ARf07E07 pKA1U5 NM_020145.2  
GGGCGGCTGCGGCGGGCGGGCAGGCGGGCAGGCCGNTTAGGCGGNTGCGCGGAGGGCTGG
HKR389234 RBd73B10 pGCAP10 NM_020145.2  
GCTGCCCNNNNNNNNNNTGGCTCGGCGGCTGCGGCGGGCGGGCAGGCGGGCAGGCCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl