Prev. |  KEGG KO K00019 > 

RIKEN DNA Bank Human Resource - BDH2

Gene ID NCBI Gene 56898 |  KEGG hsa:56898
Gene Symbol BDH2
Protein Name 3-hydroxybutyrate dehydrogenase 2
Synonyms DHRS6|EFA6R|PRO20933|SDR15C1|UCPA-OR|UNQ6308
Ortholog resource in our bank

  BDH2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018900 IRAK047E04 pBluescriptR BC037277 NM_020139 Full/var
HGY083670 IRAL009C22 pOTB7 BC001953 NM_020139 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386575 RBd66H07 pGCAP10 NM_020139.3  
CGGCCGGCCGATGATGCATTATTAAGCGCTTGACTTGCTTCCAGACAAAGGTTGTCTCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl