Prev. | 

RIKEN DNA Bank Human Resource - GPR137

Gene ID NCBI Gene 56834 |  KEGG hsa:56834
Gene Symbol GPR137
Protein Name G protein-coupled receptor 137
Synonyms C11orf4|GPR137A|TM7SF1L1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186884 ARi67D12 pGCAP10 NM_020155.2  
GAGCGGGAGCCGGGGAGCCGGAGCCCCGGGTCCCCACGACCTGAGCCGGCTCTCCCATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl