Prev. |  KEGG KO K07953 > 

RIKEN DNA Bank Human Resource - SAR1A

Gene ID NCBI Gene 56681 |  KEGG hsa:56681
Gene Symbol SAR1A
Protein Name secretion associated Ras related GTPase 1A
Synonyms SAR1|SARA1|Sara|masra2
Ortholog resource in our bank

  SAR1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084438 IRAL011B14 pOTB7 BC003658 NM_020150 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081216 M01C003A16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081264 M01C003C16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081312 M01C003E16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081360 M01C003G16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081408 M01C003I16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081456 M01C003K16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081504 M01C003M16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE081552 M01C003O16 pDONR221 04-134-2_2-B08 BC003658 NM_020150  
HGE098012 M01C045A12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098060 M01C045C12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098108 M01C045E12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098156 M01C045G12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098204 M01C045I12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098252 M01C045K12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098300 M01C045M12 pDONR221 MGC12-B06 BC003658 NM_020150  
HGE098348 M01C045O12 pDONR221 MGC12-B06 BC003658 NM_020150  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004502 W01A011E06 pENTR-TOPO IRAL011B14 BC003658 NM_020150  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056860 ARe42C12 pKA1U5 NM_020150.4  
GAGTAGCTGGCGGTCCCGGGTGCTGCTGGTTAGTGTGCTCTGAGGGAGGGTCCGAGCCAG
HKR174854 ARi37C06 pGCAP10 NM_020150.4  
GGTACATCCGGCGAGTAGCTGGCGGTCCCGGGTGCTGCTGGTTAGTGTGCTCTGAGGGAG
HKR474869 RBdS187C21 pGCAP10 NM_020150.4  
GACATCCGGCGAGTAGCTGGCGGTCCCGGGTGCTGCTGGTTAGTGTGCTCTGAGGGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl