Prev. |  KEGG KO K04921 > 

RIKEN DNA Bank Human Resource - KCNK12

Gene ID NCBI Gene 56660 |  KEGG hsa:56660
Gene Symbol KCNK12
Protein Name potassium two pore domain channel subfamily K member 12
Synonyms K2p12.1|THIK-2|THIK2
Ortholog resources KEGG ortholog (KEGG orthology K04921) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039479 IRAK098L15 pCMV-SPORT6 BC047749 NM_022055 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE034426 W01A086B02 pENTR-TOPO IRAK098L15 BC047749 NM_022055 done
HGE034428 W01A086B04 pENTR-TOPO IRAK098L15 BC047749 NM_022055  
HGE034430 W01A086B06 pENTR-TOPO IRAK098L15 BC047749 NM_022055  
HGE034432 W01A086B08 pENTR-TOPO IRAK098L15 BC047749 NM_022055  
HGE034436 W01A086B12 pENTR-TOPO IRAK098L15 BC047749 NM_022055  
HGE034438 W01A086B14 pENTR-TOPO IRAK098L15 BC047749 NM_022055  
HGE034442 W01A086B18 pENTR-TOPO IRAK098L15 BC047749 NM_022055  
HGE034446 W01A086B22 pENTR-TOPO IRAK098L15 BC047749 NM_022055  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444096 RBdS110D24 pGCAP10 NM_022055.1 done
GGCTCTTCGGCTGGAGCTGAGAAAGGAGCGCTTCCCCGGACTCGGCTCGGCTCCGAGGCT
HKR475131 RBdS187N19 pGCAP10 NM_022055.1  
TGGGCTCCGAGGCTCCGAAGCCGACGCCGCCAGCTCAGCCCCGGGGGCGGGAGCAGGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl