Prev. |  KEGG KO K03506 > 

RIKEN DNA Bank Human Resource - POLE4

Gene ID NCBI Gene 56655 |  KEGG hsa:56655
Gene Symbol POLE4
Protein Name DNA polymerase epsilon 4, accessory subunit
Synonyms YHHQ1|p12
Ortholog resources KEGG ortholog (KEGG orthology K03506) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097508 IRAL043M20 pOTB7 BC031331 NM_019896 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049369 ARe23H01 pKA1U5 NM_019896.2  
GAGTCGGCGGCCGCGCGCAGCACGCTCAAGGCCGGGATGGCGGCGGCGGCGGCGGCAGGA
HKR181652 ARi54C04 pGCAP10 NM_019896.2  
GAAGGCCGGGATGGCGGCGGCGGCGGCGGCAGGAAGCGGGACGCCCCGAGAGGAGGAGGT
HKR184834 ARi62B10 pGCAP10 NM_019896.2  
AGCACGCTCAAGGCCGGGATGGCGGCGGCGGCGGCGGCAGGAAGCGGGACGCCNCGAGAG
HKR209578 ARiS023P18 pGCAP10 NM_019896.2  
GGGCCGCGCGCAGCACGCTCAAGGCCGGGATGGCGGCGGCGGCGGCGGCAGGAAGCGGGA
HKR390152 RBd75G08 pGCAP10 NM_019896.2  
TGACTGTCCGCGGCCGCGCGCAGCACGCTCAAGGCCGGGATGGCGGCGGCGGCGGCGGCA
HKR420489 RBdS051D17 pGCAP10 NM_019896.2  
GGCGGCGGCGGCGGCAGGAAGCGGGACGCCCCGAGAGGAGGAGGGACCTGCTGGGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl