Prev. | 

RIKEN DNA Bank Human Resource - CLDND1

Gene ID NCBI Gene 56650 |  KEGG hsa:56650
Gene Symbol CLDND1
Protein Name claudin domain containing 1
Synonyms C3orf4|GENX-3745|Z38
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04311 pBluescript II KS(-)-iGPCR2201 Plasmid clone of human intron-less G coupled receptor gene
RDB04340 pAxCALNLhiGPCR2201 (forward) Shuttle vector to generate rAd harboring human intron-less G coupled receptor gene
RDB04369 pAxCALNLhiGPCR2201 (reverse) Shuttle vector to generate rAd harboring human intron-less G coupled receptor gene

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008677 IRAK021L13 pCMV-SPORT6 BC013610 NM_019895 Full
HGY013147 IRAK032O11 pBluescriptR BC022551 NM_019895 Full
HGY082938 IRAL007F18 pOTB7 BC001757 NM_019895 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004838 W01A012B14 pENTR-TOPO IRAK021L13 BC013610 NM_019895  
HGE017610 W01A044A10 pENTR-TOPO IRAL007F18 BC001757 NM_019895  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248801 ARiS122A01 pGCAP10 NM_001040181.1  
GCTTCTCCGGCCCCGCCGTGAGGCCCAGGAGGTGGCTGCTGCAGGCGTCCGGCTTGGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl