Prev. |  KEGG KO K10522 > 

RIKEN DNA Bank Human Resource - DIABLO

Gene ID NCBI Gene 56616 |  KEGG hsa:56616
Gene Symbol DIABLO
Protein Name diablo IAP-binding mitochondrial protein
Synonyms DFNA64|SMAC
Featured content Apoptosis - human
Ortholog resource in our bank

  DIABLO

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043112 IRAK107M24 pCMV-SPORT6 BC046209 NM_019887 Full
HGY085534 IRAL013N22 pOTB7 BC004417 NM_138930 Partial
HGY091452 IRAL028K12 pOTB7 BC011909 NM_019887 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052549 ARe31G05 pKA1U5 NM_019887.3  
GGTCCGCGCGCTGCACAATGGCGGCTCTGAAGAGTTGGCTGTCGCGCAGCGTAACTTCAT
HKR164578 ARi11H10 pGCAP10 NM_019887.3  
GGCGTCTGGCGTCCGCGCGCTGCACAATGGCGGCTCTGAATAGTTGGCTGTCGCGCAGCG
HKR166408 ARi16A08 pGCAP10 NM_019887.3  
GGTGCGTCTGGCGTCCGCGCGCTGCACAATGGCGGCTCTGAAGAGTTGGCTGTCGCGCAG
HKR373372 RBd33H04 pGCAP10 NM_019887.3  
TTTTTTTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCT
HKR396897 RBd92E01 pGCAP10 NM_019887.3  
GACTTCCGGCGTGTGCGTCTGGCGTCCGCGCGCTGCACAATGGCGGCTCTGAAGAGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl