Prev. |  KEGG KO K00816 > 

RIKEN DNA Bank Human Resource - KYAT3

Gene ID NCBI Gene 56267 |  KEGG hsa:56267
Gene Symbol KYAT3
Protein Name kynurenine aminotransferase 3
Synonyms CCBL2|KAT3|KATIII
Ortholog resources KEGG ortholog (KEGG orthology K00816) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001815 IRAK004I23 pCMV-SPORT6 BC000819 NM_001008662 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238540 ARiS096F20 pGCAP10 NM_001008661.1  
GACTCGAGCCTAGGGAGGCGAGGTTCCCGCACCGGATAGCATGTTTTTGGCCCAGAGGAG
HKR260323 ARiS150N11 pGCAP10 NM_001008661.1  
GGAGGTTCCNNCACCGTATANAAAATGTCACTGAANTTCNCAAATGCAAAACGGATTGAA
HKR374083 RBd35D11 pGCAP10 NM_001008661.1  
TGGTCGGGACTCGAGCCTAGGGAGGCGAGGTTCCCGCACCGGATAGCATGTTTTTGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl