Prev. | 

RIKEN DNA Bank Human Resource - C8orf44

Gene ID NCBI Gene 56260 |  KEGG hsa:56260
Gene Symbol C8orf44
Protein Name chromosome 8 open reading frame 44
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093984 IRAL034P24 pOTB7 BC014448 NM_019607 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004129 W01A010F09 pENTR-TOPO IRAL034P24 BC014448 NM_019607  
HGE004131 W01A010F11 pENTR-TOPO IRAL034P24 BC014448 NM_019607  
HGE004133 W01A010F13 pENTR-TOPO IRAL034P24 BC014448 NM_019607  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368401 RBd21A01 pGCAP10 NM_019607.1  
GGTTAAAAACAGTTATGGCAGTGGGAGTCGAAGCGAGGGTCTGAAGTTCACGACTACTAG
HKR396408 RBd91A08 pGCAP10 NM_019607.1  
GAGGGAAGCTTGGTTAAAAACAGTTATGGCAGTGGGAGTCGAAGCGAGGGTCTGAAGTTC
HKR397225 RBd93B01 pGCAP10 NM_019607.1  
TGAAAAAACAGTTATGGCAGTGGGAGTCGAAGCGAGGGTCTGAAGTTCACGACTACTAGA
HKR398081 RBd95D09 pGCAP10 NM_019607.1  
GGGTTAAAAACAGTTATGGCAGTGGGAGTCGAAGCGAGGGTCTGAAGTTCACGACTACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl