Prev. |  KEGG KO K12864 > 

RIKEN DNA Bank Human Resource - CTNNBL1

Gene ID NCBI Gene 56259 |  KEGG hsa:56259
Gene Symbol CTNNBL1
Protein Name catenin beta like 1
Synonyms C20orf33|NAP|P14L|PP8304|dJ633O20.1
Ortholog resources KEGG ortholog (KEGG orthology K12864) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027922 IRAK069N10 pCMV-SPORT6 BC036739 NM_030877 Partial
HGY097184 IRAL042P24 pOTB7 BC022802 NM_030877 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015969 W01A039P09 pENTR-TOPO flj0017d16 AK074663 NM_030877  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040478 ARe01D06 pKA1U5 NM_030877.3  
ATCCTGGGCTGACGGGCCCGCGGTCTGGGCGTGAGTGCAGGGAAGTGGAGTATTTGCTGG
HKR040858 ARe02C10 pKA1U5 NM_030877.3  
ATCCTGGGCTGACGGGCCCGCGGTCTGGGCGTGAGTGCAGGGAAGTGGAGTATTTGCTGG
HKR361653 RBd04C05 pGCAP10 NM_030877.3  
GACGGCAGTGTGGCTGGAGCCGCGGCTGACGGGCCCGCGGTCTGGGCGTGAGTGCAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl