Prev. | 

RIKEN DNA Bank Human Resource - NSMCE3

Gene ID NCBI Gene 56160 |  KEGG hsa:56160
Gene Symbol NSMCE3
Protein Name NSE3 homolog, SMC5-SMC6 complex component
Synonyms HCA4|LICS|MAGEG1|MAGEL3|NDNL2|NSE3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033837 IRAK084J21 pCMV-SPORT6 BC041166 NM_138704 Full
HGX046179 IRAK115H11 pCMV-SPORT6 BC053999 NM_138704 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001307 W01A003E11 pENTR-TOPO IRAK115H11 BC053999 NM_138704  
HGE001311 W01A003E15 pENTR-TOPO IRAK115H11 BC053999 NM_138704  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192406 ARi81A06 pGCAP10 NM_138704.2  
GGCGCGCGCCTCCAGGCACCGGCGTTAGCGGGTCGCCGACCCGCAATCCCCGCCGCGGCT
HKR403154 RBdS007O18 pGCAP10 NM_138704.2  
GCCCCGCCGCGGCTGCTTGCCTACCGGAGTGTGCGCCGGCACCTGCCGCCGGAGACATGT
HKR474933 RBdS187F13 pGCAP10 NM_138704.2  
GATGACGCAGCACGCAGTCTCAGCCGACACTGCGCGCGCCTCCAGGCACCGGCGTTAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl