Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDNL2

Gene ID (NCBI) 56160
Gene Symbol NDNL2
Protein Name necdin-like 2
Synonyms HCA4|MAGEG1|MAGEL3|NSE3|NSMCE3
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033837 IRAK084J21 pCMV-SPORT6 BC041166 NM_138704 Full
HGX046179 IRAK115H11 pCMV-SPORT6 BC053999 NM_138704 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE001307 W01A003E11 pENTR-TOPO IRAK115H11 BC053999 NM_138704
HGE001311 W01A003E15 pENTR-TOPO IRAK115H11 BC053999 NM_138704

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR192406 ARi81A06 pGCAP10 NM_138704.2
GGCGCGCGCCTCCAGGCACCGGCGTTAGCGGGTCGCCGACCCGCAATCCCCGCCGCGGCT
HKR403154 RBdS007O18 pGCAP10 NM_138704.2
GCCCCGCCGCGGCTGCTTGCCTACCGGAGTGTGCGCCGGCACCTGCCGCCGGAGACATGT
HKR474933 RBdS187F13 pGCAP10 NM_138704.2
GATGACGCAGCACGCAGTCTCAGCCGACACTGCGCGCGCCTCCAGGCACCGGCGTTAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl