Prev. |  KEGG KO K20127 > 

RIKEN DNA Bank Human Resource - BAIAP2L1

Gene ID NCBI Gene 55971 |  KEGG hsa:55971
Gene Symbol BAIAP2L1
Protein Name BAR/IMD domain containing adaptor protein 2 like 1
Synonyms IRTKS
Ortholog resource in our bank

  BAIAP2L1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085902 IRAL014M14 pOTB7 BC013888 NM_018842

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098412 M01C046A12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098460 M01C046C12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098508 M01C046E12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098556 M01C046G12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098604 M01C046I12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098652 M01C046K12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098700 M01C046M12 pDONR221 MGC12-F06 BC013888 NM_018842  
HGE098748 M01C046O12 pDONR221 MGC12-F06 BC013888 NM_018842  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078084 ARe95D12 pKA1U5 NM_018842.3  
GCTCTGGCGGCGTCCGGCCGCTTCTCCTCTGCTCCTCGAAGAAGGCCAGGGCGGCGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl