Prev. |  KEGG KO K04347 > 

RIKEN DNA Bank Human Resource - GNG12

Gene ID NCBI Gene 55970 |  KEGG hsa:55970
Gene Symbol GNG12
Protein Name G protein subunit gamma 12
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K04347) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008449 IRAK021C01 pCMV-SPORT6 BC013090 NM_018841 Partial/var
HGY088745 IRAL021O09 pDNR-LIB BC005940 NM_018841 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045101 W01A112M13 pENTR-TOPO IRAL021O09 BC005940 NM_018841  
HGE045105 W01A112M17 pENTR-TOPO IRAL021O09 BC005940 NM_018841  
HGE045107 W01A112M19 pENTR-TOPO IRAL021O09 BC005940 NM_018841  
HGE045109 W01A112M21 pENTR-TOPO IRAL021O09 BC005940 NM_018841  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051732 ARe29F12 pKA1U5 NM_018841.4  
GAGAGGAGGAGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCC
HKR056169 ARe40H01 pKA1U5 NM_018841.4  
GAGAGACCGAGNTCCCGGCGGCGACGGCGGGGCACCGTNCCGGCAGGCGGATTCATTCCA
HKR062455 ARe56C07 pKA1U5 NM_018841.4  
GGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCCCAGTTNCCGGCGGCGACGGCGGGGCA
HKR063327 ARe58F07 pKA1U5 NM_018841.4  
GGGAGCCGGCGCCCGGAGGAGCAAGAGGAGGAGGAGGAGGAGAGGTCGGAGCCGTCTCCA
HKR079699 ARe99E03 pKA1U5 NM_018841.4  
GGCCCGGAGGAGCAAGAGGAGGAGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTT
HKR187356 ARi68G12 pGCAP10 NM_018841.4  
TGGGGGCAGCGCACCGGCAGGCGGATTCATTCCACTTAAAACCTGAAAACATTGGACCAC
HKR222286 ARiS055L22 pGCAP10 NM_018841.4  
GGGAGCAAGAGGAGGAGGAGGAGGAGAGGTCGGANCCGNNTCCAGGAGCCCTTANAGACN
HKR235318 ARiS088E22 pGCAP10 NM_018841.4  
GGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCGGCGGCGA
HKR243613 ARiS109A13 pGCAP10 NM_018841.4  
GGAGGAGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCGGC
HKR276562 ARiS191G18 pGCAP10 NM_018841.4  
GGGAGCCGGCGCCCGGAGGAGCAAGAGGAGGAGGAGGAGGAGAGGTCGGAGCCGTCTCCA
HKR276712 ARiS191M24 pGCAP10 NM_018841.4  
GGCCGGCGCCCGGAGGAGCAAGAGGAGGAGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGA
HKR374473 RBd36D01 pGCAP10 NM_018841.4  
GAGCCCTTAGAGACCGAGTCCCGGCGGCGACGGCGGGGCAGCGCACCGGCAGGCGGATTC
HKR393604 RBd84A04 pGCAP10 NM_018841.4  
GGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCGGCGGCGAC
HKR416235 RBdS040J19 pGCAP10 NM_018841.4  
GAGAGACCGAGTCCCGGCGGCGACGGCGGGGCAGCGCACCGGCAGGCGGATTCATTCCAC
HKR462498 RBdS156E02 pGCAP10 NM_018841.4  
GGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCGGCGGCGACGGCGGGGCAGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl