Prev. | 

RIKEN DNA Bank Human Resource - RAB5IF

Gene ID NCBI Gene 55969 |  KEGG hsa:55969
Gene Symbol RAB5IF
Protein Name RAB5 interacting factor
Synonyms C20orf24|PNAS-11|RCAF1|RIP5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083482 IRAL008L18 pOTB7 BC001871 NM_199483 Full/var
HGY083803 IRAL009I11 pOTB7 BC004446 NM_199483 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067773 ARe69H05 pKA1U5 NM_018840.2  
TGGGTAGAGCCGGCGGAACCGGGTAGCTTGGCCAGTTTGTGAGGAACCGCAGCGCGCCGC
HKR175372 ARi38H04 pGCAP10 NM_018840.2  
GAGAGCCGGCGGAACCGGGTAGCTTGGCCAGGTTGTGAGGAACCGCAGCGCGCCGCAGGA
HKR209277 ARiS023D05 pGCAP10 NM_018840.2  
GGTAGAGCCGGCGGAACCGGGTAGCTTGGCCAGGTTGTGAGGAACCGCAGCGCGCCGCAG
HKR249174 ARiS122P14 pGCAP10 NM_018840.2  
GGGCGGAACCGGGTAGCTTGGCCAGGTTGTGAGGAACCGCAGCGCGCCGCAGGACCGGGC
HKR332974 RBb32H06 pGCAP1 NM_018840.2  
TGAGGTTGTGAGGAACCGCAGCGCGCCGCAGGACCGGGCCGCTTTAGCCTGCAGCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl