Prev. |  KEGG KO K14012 > 

RIKEN DNA Bank Human Resource - NSFL1C

Gene ID NCBI Gene 55968 |  KEGG hsa:55968
Gene Symbol NSFL1C
Protein Name NSFL1 cofactor
Synonyms P47|UBX1|UBXD10|UBXN2C|dJ776F14.1
Ortholog resource in our bank

  NSFL1C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE029257 W01A073C09 pENTR-TOPO flj0034m24 AK001511 NM_018839 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056548 ARe41G04 pKA1U5 NM_016143.3 done
TGACGGGGCGAAGATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTGGCGGTGAC
HKR249073 ARiS122L09 pGCAP10 NM_016143.3  
GGAAGGCGCACGGGGCGAAGATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTGG
HKR322075 RBb05D03 pKA1U5 NM_016143.3  
GGGAAGGCGCACGGGGCGAAGATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTG
HKR342849 RBb57C01 pGCAP1 NM_016143.3  
GGGGGCGAAGATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTGGCGGTGACGGG
HKR347679 RBb69D07 pGCAP1 NM_016143.3  
GGGGGCGAAGATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTGGCGGTGACGGG
HKR416160 RBdS040G16 pGCAP10 NM_016143.3  
GGGAAGGCGCACGGGGCGAAGATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl