Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFA12

Gene ID (NCBI) 55967
Gene Symbol NDUFA12
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Synonyms B17.2|DAP13
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11352)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY088415 IRAL021A15 pDNR-LIB BC005936 NM_018838 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096426 M01C041B02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096474 M01C041D02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096522 M01C041F02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096570 M01C041H02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096618 M01C041J02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096666 M01C041L02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096714 M01C041N02 pDONR221 MGC10-D01 BC005936 NM_018838  
HGE096762 M01C041P02 pDONR221 MGC10-D01 BC005936 NM_018838  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046505 ARe16E09 pKA1U5 NM_018838.3  
GGCCAGCGAGGCAAGATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATCACC
HKR062083 ARe55D11 pKA1U5 NM_018838.3  
GGGGGCCAGCGAGGCAAGATGGAGTTAGGTGCACCCTCNTGAAACGCGGGCTGCAGCAGA
HKR064529 ARe61F09 pKA1U5 NM_018838.3  
TGGGGGCCAGCGAGGCAAGATGGAGTTAGTGCACGTTCTGAAACGCGGGCTGCAGCAGAT
HKR384547 RBd61G03 pGCAP10 NM_018838.3  
GGGGGCCAGCGAGGCAAGATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATC
HKR397726 RBd94F06 pGCAP10 NM_018838.3  
GACCCGGGAGGCGGGGCCAGCGAGGCAAGATGGAGTTAGTGCAGGTCCTGAAACGCGGGC
HKR405944 RBdS014O08 pGCAP10 NM_018838.3  
GACTGGCACCCCAGAACAATATGTACCTTATTCTACCACTAGAAAGAAGATTCAGGAGTG
HKR462472 RBdS156C24 pGCAP10 NM_018838.3  
GAGCGAGGCAAGATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATCACCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl