RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SEPTIN3

Gene ID	NCBI Gene 55964 \| KEGG hsa:55964
Gene Symbol	SEPTIN3
Protein Name	septin 3
Synonyms	SEP3\|SEPT3\|bK250D10.3

Ortholog resource in our bank

  SEPTIN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR387728	RBd69F08	pGCAP10	NM_019106.5
HKR387728	GGCCGAGCGAGCCGAGGCGAGGTCCCGGGGAGGGCGCGGCGGCGCGGGGCGCAGGGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl