Prev. | 

RIKEN DNA Bank Human Resource - RCC2

Gene ID NCBI Gene 55920 |  KEGG hsa:55920
Gene Symbol RCC2
Protein Name regulator of chromosome condensation 2
Synonyms TD-60
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046380 IRAK115P20 pCMV-SPORT6 BC053908 NM_018715 Full
HGY097969 IRAL044P09 pOTB7 BC042141 NM_018715 Full
HGY085397 IRAL013I05 pOTB7 BC004933 NM_018715 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE095615 M01C039A15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095663 M01C039C15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095711 M01C039E15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095759 M01C039G15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095807 M01C039I15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095855 M01C039K15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095903 M01C039M15 pDONR221 MGC09-A08 BC053908 ENST00000375436  
HGE095951 M01C039O15 pDONR221 MGC09-A08 BC053908 ENST00000375436  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078904 ARe97E08 pKA1U5 NM_018715.1  
GGTTCTGGAAGCTCGTATTTACATTTTAAGTGTATCTGGTGAGTGGGCTGGAGCCCTCGT
HKR444337 RBdS110O01 pGCAP10 NM_018715.1  
GACATTTTANNTGTNTCTGGTGAGTGGGCTGGAGCCCTCGTCTGGGCCGGAAAAAAAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl