Prev. |  KEGG KO K20120 > 

RIKEN DNA Bank Human Resource - BIN3

Gene ID NCBI Gene 55909 |  KEGG hsa:55909
Gene Symbol BIN3
Protein Name bridging integrator 3
Synonyms -
Ortholog resource in our bank

  BIN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036095 IRAK090D23 pBluescript BC050314 NM_018688
HGY083501 IRAL008M13 pOTB7 BC001223 NM_018688 Partial
HGY090229 IRAL025J13 pOTB7 BC009824 NM_018688 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040521 ARe01F01 pKA1U5 NM_018688.4  
TGGAATCCGGAAGTGACCCTAGAGAAACGAGTTGTNGCTGAGGACCCCGGCGGCAGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl