DNA Bank Top | 

RIKEN DNA Bank Human Resource - ZC4H2

Gene ID NCBI Gene 55906 |  KEGG hsa:55906
Gene Symbol ZC4H2
Protein Name zinc finger C4H2-type containing
Synonyms HCA127|KIAA1166|MCS|MRXS4|WRWF|WRWFFR|WWS

Link

Ortholog resource in our bank


External database

human ZC4H2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04918 SEREX clone NGO-Pr-32 (ID 640) #1 SEREX clone NGO-Pr-32 (ID 640) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085240 IRAL013B16 pOTB7 BC004411 NM_018684 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176849 ARi42C01 pGCAP10 NM_018684.1  
GGCTGGCGCCGCTGTCGGAGCTCAGACCAGCAGGCCTACGACCTAGAAAGTGCTCAAAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl