Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF302

Gene ID NCBI Gene 55900 |  KEGG hsa:55900
Gene Symbol ZNF302
Protein Name zinc finger protein 302
Synonyms HSD16|MST154|MSTP154|ZNF135L|ZNF140L|ZNF327
Ortholog resource in our bank

  ZNF302

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013286 IRAK033D14 pBluescriptR BC024176 NM_018443 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041784 W01A104H16 pENTR-TOPO IRAK033D14 BC024176 NM_018443  
HGE041786 W01A104H18 pENTR-TOPO IRAK033D14 BC024176 NM_018443  
HGE041790 W01A104H22 pENTR-TOPO IRAK033D14 BC024176 NM_018443  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203273 ARiS008D01 pGCAP10 NM_001012320.1  
GGGGGCAGTGTCGTTCCCGGAGGTCGGCCGCCGTTACCCGCTCACCAGCTACGCGGCGCG
HKR364903 RBd12E07 pGCAP10 NM_001012320.1  
GGAAATGTGGTTCGCCGTGGGCGGTGCACTGGGTCAGTCCAGCGATAGCTTCAGGCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl