Prev. |  KEGG KO K11405 > 

RIKEN DNA Bank Human Resource - HDAC8

Gene ID NCBI Gene 55869 |  KEGG hsa:55869
Gene Symbol HDAC8
Protein Name histone deacetylase 8
Synonyms CDA07|CDLS5|HD8|HDACL1|KDAC8|MRXS6|RPD3|WTS
Ortholog resources KEGG ortholog (KEGG orthology K11405) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05103 pAxCALNLhHDAC8(forward) Shuttle vector to generate rAd expressing human HDAC8
RDB05353 pAxCALNLhHDAC8 (forward) Shuttle vector to generate rAd harboring human HDAC8 (forward)
RDB05461 pAxCALNLhHDAC8 (reverse) Shuttle vector to generate rAd harboring human HDAC8 (reverse)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039348 IRAK098G04 pCMV-SPORT6 BC050433 NM_018486 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025154 W01A062O18 pENTR-TOPO IRAK098G04 BC050433 NM_018486 done
HGE025156 W01A062O20 pENTR-TOPO IRAK098G04 BC050433 NM_018486  
HGE025160 W01A062O24 pENTR-TOPO IRAK098G04 BC050433 NM_018486  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238650 ARiS096K10 pGCAP10 NM_018486.1  
GAGATCTGGAAGGTGGCTGCGGAACGGTTTTAAGCGGAAGATGGAGGAGCCGGAGGAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl